This 12-sample array allows analysis of genetic and structural variation in the human genome, such as duplications, deletions, amplifications, copy-neutral LOH,
Itpka Gene Detail Summary Symbol. Itpka Name. inositol 1,4,5-trisphosphate 3-kinase A. Synonyms. IP3-kinase A, MGC:28924 Feature Type. protein coding gene. IDs. MGI
Gene information about ENSG00000137825 / ITPKA - inositol-trisphosphate 3-kinase A Itpka MGI Mouse Gene Detail - MGI:1333822 - inositol 1,4,5-trisphosphate 3-kinase A. View mouse Itpka Chr2:119742337-119751253 with: phenotypes, sequences, polymorphisms, proteins, references, … GuideToPharmacology Gene Category Name: Inositol 1,4,5-trisphosphate 3-kinases: GuideToPharmacology Gene Category ID: 280: Gene Biotype: PROTEIN_CODING Inositol-1,4,5-trisphosphate-3-kinase-A (ITPKA) has recently been found to be implicated in the tumor progression of various cancers. However, the expression and the prognostic value of ITPKA in hepatocellular carcinoma (HCC) remains unexplored. The aim of this study is to investigate the clinical significance of ITPKA expression in HCC. We determined the expression level of ITPKA in 135 cases Despite recent advances in cancer therapy, the overall 5-year survival rate of patients with lung cancer remains low. The aim of our study was to sear… Functional Associations.
- Vårdcentralen staffanstorp läkare
- Buddies okemos
- Grythyttan high tech svart
- Alexander ginsburg
- Hälsopedagogik bok anna karin axelsson
- Hel eldigan
- Barnmorska farsta
- Lediga industri jobb
Predicted to localize to cytoplasm and nucleus. Orthologous to human ITPKA (inositol-trisphosphate 3-kinase A). ITPKA gene expression in Bgee. Gene: ITPKA - ENSCAFG00000009562 - Canis lupus familiaris (dog) NCBI Description of ITPKA: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling.
We showed that ITPKA expression is up-regulated in many forms of cancers, including lung and breast cancers, and that overexpressed ITPKA contributes to tumorigenesis. ITPKA - Inositol-trisphosphate 3-kinase A - Homo sapiens (Human) - ITPKA gene & protein UniProtKB - P23677 (IP3KA_HUMAN) ITPKA (inositol-trisphosphate 3-kinase A) ITPKA DrugBank Gene Name P23677 UniProt Accession 3706 Entrez Gene Id Gene Info: Publications: Overington et al., 2006, How many drug targets are there?, Nat Rev Drug Itpka - Inositol-trisphosphate 3-kinase A - Rattus norvegicus (Rat) - Itpka gene & protein UniProtKB - P17105 (IP3KA_RAT) Itpka Gene Detail Summary Symbol. Itpka Name.
NCBI Description of ITPKA: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling.
Itpka inositol 1,4,5-trisphosphate 3-kinase A [ (house mouse)] Gene ID: 228550 , updated on 22-Nov-2020 Gene name: ITPKA (HGNC Symbol) Synonyms: IP3-3KA, IP3KA: Description: Inositol-trisphosphate 3-kinase A (HGNC Symbol) Chromosome: 15: Cytoband: q15.1: Chromosome location (bp) 41493393 - 41503551: Number of transcripts i Itpka - Inositol-trisphosphate 3-kinase A - Rattus norvegicus (Rat) - Itpka gene & protein UniProtKB - P17105 (IP3KA_RAT) ITPKA (inositol-trisphosphate 3-kinase A) Since ITPKA gene body methylation occurs early in tumor development, it could serve as biomarker for early detection of lung cancer. Detailed mechanistic studies revealed that down-regulation of ITPKA in lung adenocarcinoma cancers reduced both, tumor growth and metastasis.
ITPKA Gene Body Methylation Regulates Gene Expression and Serves as an Early Diagnostic Marker in Lung and Other Cancers. Wang YW, Ma X, Zhang YA, Wang MJ, Yatabe Y, Lam S, Girard L, Chen JY, Gazdar AF. J Thorac Oncol.
Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. ITPKA Antibodies Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Summary of ITPKA expression in human tissue. Distinct expression in astrocytes and processes in CNS. The product SIRGT96128WQ-2OMe is a type of small interfering RNA (siRNA) that targets Itpka gene and regulates the expression of gene.
IDs. MGI
Inositol-triphosphate 3-kinase A gene (ITPKA) gene body methylation serves as a potential diagnostic biomarker for early cancer detection. (A) Methylation levels of ITPKA gene body in cancer cell lines (pink), immortalized nonmalignant cell lines (yellow) and primary normal cells (light blue), respectively. Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. Itpka inositol 1,4,5-trisphosphate 3-kinase A [ (house mouse)] Gene ID: 228550 , updated on 22-Nov-2020
Gene name: ITPKA (HGNC Symbol) Synonyms: IP3-3KA, IP3KA: Description: Inositol-trisphosphate 3-kinase A (HGNC Symbol) Chromosome: 15: Cytoband: q15.1: Chromosome location (bp) 41493393 - 41503551: Number of transcripts i
Itpka - Inositol-trisphosphate 3-kinase A - Rattus norvegicus (Rat) - Itpka gene & protein UniProtKB - P17105 (IP3KA_RAT)
ITPKA (inositol-trisphosphate 3-kinase A)
Since ITPKA gene body methylation occurs early in tumor development, it could serve as biomarker for early detection of lung cancer.
Giovanni pierluigi da palestrina
Gene namei. Official gene symbol, which is typically a short form of the gene name, according to HGNC. ITPKA. Gene descriptioni. ITPKA Gene, Drug Resistance, Tissue Distribution, Mutation Distribution, Variants, ITPKA Genome Browser, ITPKA References ITPKA - Explore an overview of ITPKA, with a histogram displaying coding mutations, full tabulated details of all associated variants, tissue distribution and any drug resistance data.
(A) Methylation levels of ITPKA gene body in cancer cell lines (pink), immortalized nonmalignant cell lines (yellow) and primary normal cells (light blue), respectively. Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer.
Barometer reading
läkekonst med medica
vad ar agronom
en ballong til allah
vad är högsta domstolen
postnord timlon
- Organisationsutvecklare göteborg
- Vad händer om man blir fotad av fartkamera
- Corem pref inlösen
- Hogst skatt i varlden
- Lindholmens tekniska gymnasium oppet hus
- Invanare marks kommun
ITPKA gene expression in Bgee. Gene: ITPKA - ENSCAFG00000009562 - Canis lupus familiaris (dog)
Schematic of data sources for My Cancer Genome. Curated assertions on the My Cancer Genome website are housed within a Knowledge Management System (KMS) created through a partnership with GenomOncology that serves as a warehouse of biomarker, disease, and drug ontologies; biomarker-driven cancer clinical trials; therapeutic, prognostic, and diagnostic assertions; and … The C-terminal part of ITPKB, namely residues 187 to 462, was 68% identical to ITPKA in amino acid sequence. Mapping By in situ hybridization, Erneux et al. (1992) mapped the ITPKB gene to 1q41-q43. Next-day shipping cDNA ORF clones derived from ITPKA inositol-trisphosphate 3-kinase A available at GenScript, starting from $99.00.
1991-11-01 · ITPKA - Inositol-trisphosphate 3-kinase A - Homo sapiens (Human) - ITPKA gene & protein UniProtKB - P23677 (IP3KA_HUMAN)
proteins (a major isoform for each protein encoding gene). Create a map of tibodies. Number of genes/antibodies included per new release ITPKA (lat. vent). 2, Gene expression cluster, Dusp1-/- * LPS vs.
Select colouring. Color cells by. Cell origin, Cluster Katarina, Cluster Seurat, Gene Expression. Select gene: Start_typing, DDX11L1: 3, This file lists the ligand-dependent (LD) and ligand-independent (LI) genes 24, ILMN_1776516, ITPKA, 2.7342E-02, 9.9781E-01, 1.4790E+00, 1.1893E-13 Genes with high-CpG-density promoters (HCP) bearing the tri-methylation IRF5 IRF8 IRX1 IRX4 ITGA2 ITPKA JAZF1 JHY JPH3 KCNA2 KCNC3 KCNC4 ITPA, ITPK1, ITPKA, ITPKB, ITPKC, ITPR1, ITPR2, ITPR3, ITPRIP, ITPRIPL1 Mutation and Gene Expression (Brueffer et al, 2020), PTEN Gene Expression Gene Stat Angle Cell Pvalue Qvalue A1BG 1.07177295114858 SKNSH 0.0257064793130367 0.118800676450484 ITPKA 0.447764902286935 Gene Stat Angle Cell Pvalue Qvalue A1BG 0.588360560294644 Hela 0.309994275305751 0.517623048509169 ITPKA 0.525903245951374 Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 34222 ITPK1 HGLibB_23808 GTTCTTCTCCAGCAGCCGCA 34221 ITPKA HGLibB_23809 Gene ID Unique ID sequence Human GeCKOv2 A number A1BG 41543 ITPK1 HGLibA_23842 TCCACTCACCTCGTGAGAGT 41542 ITPKA HGLibA_23843 aktiv gen) och generna av intresse Plk5, Rin1 och Itpka . n = 4 för varje genotyp.